vcvetu.ru:
Советы
Доклады
Лекции

Растения
Цветы
Дерьвья
Огород
Удобрения
Уход

опубликовать

Продуктивные качества свиней пород дюрок и скороспелая мясная степного типа разных генотипов по локусам esr и h-fabp


Скачать 491.99 Kb.
НазваниеПродуктивные качества свиней пород дюрок и скороспелая мясная степного типа разных генотипов по локусам esr и h-fabp
страница1/3
Дата22.04.2013
Размер491.99 Kb.
ТипАвтореферат
  1   2   3




Н


а правах рукописи


КАГРАМАНОВ АРАМ РОМАЕВИЧ

Продуктивные качества свиней пород дюрок и скороспелая мясная степного типа разных генотипов по локусам ESR и H-FABP
06.02.07 – разведение, селекция и генетика

сельскохозяйственных животных


АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Ставрополь 2011

Работа выполнена в ГНУ Ставропольский научно-исследовательский институт животноводства и кормопроизводства Россельхозакадемии
Научный руководитель: доктор сельскохозяйственных наук, профессор Семенов Владимир Владимирович
Официальные оппоненты: доктор ветеринарных наук, профессор

Грига Эдуард Николаевич

доктор биологических наук

Селионова Марина Ивановна


Ведущая организация: Государственное научное учреждение

Всероссийский

научно-исследовательский институт

генетики и разведения

сельскохозяйственных животных

Россельхозакадемии (ГНУ ВНИИГиРЖ РАСХН)

Защита диссертации состоится « 20 » мая 2011 г. в «1130» ч. на заседании диссертационного совета Д 006.078.01 при Ставропольском научно-исследовательском институте животноводства и кормопроизводства по адресу: 355017, Россия, Ставропольский край, г. Ставрополь, пер. Зоотехнический, 15, тел./факс (8652) 71-70-33.
С диссертацией можно ознакомиться в библиотеке ГНУ СНИИЖК Россельхозакадемии

Автореферат разослан и размещен на официальном сайте института - http:www.sniizhk.ru « 19 » апреля 2011 г.


Ученый секретарь

диссертационного совета Кононова Л.В.

1. Общая характеристика работы

1.1 Актуальность темы. Современное свиноводство активно осваивает интенсивные технологии, динамично развивается, что обеспечивает устойчивое увеличение производства продукции. Однако на практике биологический и генетический потенциал животных реализуется ещё не в полной мере.

Создание специализированных линий свиней, имеющих лучшие в популяции продуктивные и потребительские качества невозможно без применения современных методов генетики. Работа по изучению генов, их маркирование и взаимосвязи с хозяйственно-полезными признаками позволяет улучшать популяции, породы, вести целенаправленное наследование признаков и совершенствовать селекционный процесс, опираясь на генодиагностику. Более детальное изучение и внедрение генетики к традиционным методам отбора животных, позволит ускорить селекционный процесс в свиноводстве.

1.2. Цель и задачи исследований. Цель работы – установление влияния аллельных вариантов генов эстрогенового рецептора (ESR) и гена белка связывающего жирные кислоты (H-FABP) с воспроизводительными и мясными качествами свиней пород дюрок и скороспелая мясная степного типа (СМ-1 СТ).

В задачи исследований входило:

1. Изучить полиморфизм генов ESR и H-FABP у свиней пород дюрок и скороспелая мясная степного типа разных половозрастных групп.

2. Изучить влияние аллельных вариантов гена эстрогенового рецептора на воспроизводительные качества свиней пород дюрок и скороспелая мясная степного типа.

3. Изучить влияние аллельных вариантов гена белка, связывающего жирные кислоты на откормочные и мясные качества свиней пород дюрок и скороспелая мясная степного типа.

4. Рассчитать экономическую эффективность внедрения ДНК-диагностики генов ESR и H-FABP при разведении и селекции свиней.

1.3. Научная новизна. Получены новые данные, отображающие особенности частот встречаемости маркерных аллелей генов ESR и H-FABP у свиней породы дюрок и СМ-1 СТ, разводимых в Ставропольском крае. Оценен полиморфизм генов ESR и H-FABP свиней и влияние аллельных вариантов генов на воспроизводительные, откормочные и мясные качества свиней пород дюрок и скороспелая мясная степного типа.

1.4. Практическая значимость. Проведенные исследования позволяют определить продуктивные возможности свиней различных генотипов по локусам генов ESR и H-FABP. Установлена роль ДНК-диагностики по маркерам связанным с хозяйственно-полезными признаками свиней, что позволяет целенаправленно вести отбор для последующих генераций.

Данные о аллельных вариантах генов и результатах оценки их влияния на хозяйственно-полезные признаки используются в хозяйствах Ставропольского края при разработке селекционно-генетических программ совершенствования стад, направленных на увеличение продуктивности свиней.

Результаты диссертационных исследований внедрены в ОАО “Совхоз им. Кирова” Труновского района, СПК “Родина” Красногвардейского района Ставропольского края.

1.5. Основные положения диссертационной работы, выносимые на защиту:

- особенности формирования воспроизводительных качеств свиней с учетом полиморфизма гена эстрогенового рецептора;

- особенности формирования мясной продуктивности с учетом полиморфизма гена белка связывающего жирные кислоты;

- влияние аллельных вариантов генов ESR и H-FABP на воспроизводительную и мясную продуктивность свиней пород дюрок и СМ-1 СТ.

1.6. Апробация работы. Основные положения диссертации доложены на ежегодных отчетах лаборатории свиноводства, на заседаниях Ученого совета ГНУ СНИИЖК в 2008 – 2010 гг. (г. Ставрополь); Всероссийской научно-практической конференции «Актуальные проблемы производства свинины в РФ» (п. Нижний Архыз, 2008); Международной научно-практической конференции «Современные достижения биотехнологии воспроизводства – основа повышения продуктивности сельскохозяйственных животных» (г. Ставрополь, 2009); XVII международной научно-практической конференции по свиноводству «Современные проблемы интенсификации производства свинины в странах СНГ» (г. Ульяновск, 2010).

1.7. Публикация результатов исследований. По материалам диссертации опубликовано 9 научных работ, в т.ч. 3 - в издании, рекомендованном ВАК РФ.

1.8. Объем и структура диссертации. Диссертация изложена на 107 страницах компьютерного текста, содержит 20 таблиц, 9 рисунков, включает введение, обзор литературы, материал и методы исследования, результаты собственных исследований, обсуждения, выводы, предложения производству, список литературы (насчитывающий 156 источников, в т. ч. 34 зарубежных), приложение.

2. Материал и методы исследований

Исследования проводились в ОАО “Совхоз им. Кирова” Труновского района Ставропольского края в период с 2007 по 2010 гг. Объектом исследования являлись свиньи пород: дюрок и скороспелая мясная степного типа. Схема исследований приведена на рисунке 1.



Рис 1. Общая схема исследований

Животные опытных групп находились в одинаковых условиях кормления и содержания.

Полиморфизм генов эстрогенового рецептора (ESR) и белка связывающего жирные кислоты (H-FABP) определяли с помощью полимеразной цепной реакции (ПЦР) по методике Л.А. Калашниковой (1997), Н.А. Зиновьевой (1999), используя соответствующие праймеры.

Выделение ДНК из проб крови проводили с помощью реагентов DIAtomTM DNA Prep 100 (ООО «Лаборатория Изоген», г.Москва). Амплификация проводилась набором реагентов для PCR амплификации ДНК – GenеPak PCR Core.

Для амплификации участка генов использовалась следующая последовательность праймеров:

- для участка гена эстрогенового рецептора:

5´ GACTGTTCCCTTCTGAGACTTAATG 3´

5´ CTCTTGGGAAAATGTCCTGAATTTAG 3´

- для амплификации гена H-FABP:

Аллель D: FABP3: ATT CAG CTA CTC AGC TGT TTC C 3'

FABP4: AAC AAA CTC TCA GGA ATG GGA G 3'.

Аллель Н: FABP1: 5'AAG AGG ACC AAG ATG CCT ACG 3'

FABP2: 5' TGC TGT CCA CTA GCT TCC AGG 3'.

Полученные пробы разрезаны и разделены в агарозном геле с помощью эндонуклеазы Pvu II (ESR), Hinf I (H-FABP, по типу Н), Hae III (H-FABP, по типу D).

Для оценки мясной продуктивности свиней был проведен контрольный убой при достижении животными 100 кг живой массы по методике ВИЖа (1974).

Экономическую эффективность результатов научно- производственного эксперимента определяли по «Методике определения экономической эффективности использования в сельском хозяйстве результатов научно – исследовательских испытаний опытно – конструкторских работ, новой технике, изобретений и рационализаторских предложений» (Г.М. Лоза, 1994).

Полученные цифровые данные обрабатывались методами описательной статистики. Определение достоверности разницы между исследуемыми значениями проводились посредством применения критерия однофакторного дисперсионного анализа при Р <0,05*; Р <0,01**; Р <0,001*** (Г.Ф. Лакин, 1990; В.М. Зайцев и др., 2003; Д.А. Новиков, 2005), а также на ПК с использованием пакета программ «Microsoft Office 2003».
3. Результаты исследований

3.1 Полиморфизм гена эстрогенового рецептора и его влияние на воспроизводительные качества свиней разных пород

Необходимость углубленного изучения генетических факторов, влияющих на многоплодие, обусловлена тем, что этот признак, в значительной мере, определяет продуктивность свиней и имеет низкий коэффициент наследуемости, в этой связи поиск и использование генетически предрасположенных животных к многоплодию, имеет большое практическое значение в селекции. Основным моментом наших исследований явилось изучение полиморфизма гена ESR у свиней пород дюрок и скороспелой мясной степного типа.

Частота встречаемости аллеля А в воспроизводящей части стада (хряки, свиноматки) составила от 0,675 до 1,0, в тоже время предпочтительный для селекции аллельный вариант В у представленных животных был низок и составил – 0,2 – 0,3 соответственно (табл. 1).

Таблица 1 - Частота встречаемости генотипов гена ESR в разных половозрастных группах пород дюрок и СМ-1 СТ


Порода

Половозрастные группы

n

Частота аллелей

Частота генотипов, %

А

В

АА

АВ

ВВ

дюрок

свиноматки

20

0,675

0,325

55,0

25,0

20,0

хряки

5

1,0

-

100,0

-

-

поросята

50

0,64

0,36

64,0

36,0

-

СМ-1 СТ

свиноматки

20

0,65

0,35

45,0

40,0

15,0

хряки

5

0,80

0,20

60,0

40,0

-

поросята

50

0,69

0,31

44,0

50,0

6,0


Полиморфизм по гену ESR у свиноматок породы дюрок и скороспелой мясной степного типа, представлен гомозиготным АА и гетерозиготным АВ генотипами. При этом частота встречаемости у указанных пород составила – 55,0 и 25,0%, 45,0 и 40,0% соответственно. В 20,0% случаев выявлено присутствие гомозиготного ВВ генотипа у свиноматок породы дюрок и 15% - у СМ-1 СТ. Однако у хряков породы дюрок полиморфизм данного гена не выявлен и представлен гомозиготным АА генотипом (100%). У хряков породы СМ-1 СТ частота встречаемости генотипов составила АА – 60%, АВ – 40%. Предпочтительный для селекции генотип ВВ у хряков данных пород не выявлен.

Генотипирование молодняка позволило выявить высокую частоту встречаемости генотипа АА (64%), низкую – АВ (36%) и отсутствие – ВВ генотипов среди поросят породы дюрок. Среди поросят породы СМ-1 СТ установлены незначительные отличия по генотипам АА и АВ, что составило 44 и 50% соответственно, гетерозиготный ВВ генотип выявлен у 6% поросят. Однако, при высокой частоте встречаемости аллеля А (0,64), в генном наборе потомства породы дюрок частота встречаемости аллеля В составила всего лишь 0,36. В то же время, у потомков породы скороспелая мясная степного типа частота встречаемости желательного для селекции аллеля В эстрогенового рецептора составила 0,31.

В сравнительном аспекте частота встречаемости генотипов гена ESR у свиней изученных пород представлена в табл. 2.

Таблица 2 - Частота встречаемости генотипов гена эстрогенового рецептора свиней пород дюрок и СМ-1 СТ



Порода


n

Частота

аллелей

Частота генотипов


χ2

А

В

АА

АВ

ВВ

n

%

n

%

n

%

Дюрок

75

0,79

0,21

48

64,0

23

30,7

4

5,3

0,315

СМ-1 СТ

75

0,69

0,31

34

45,3

35

46,7

6

5,3

0,702


Основная масса животных (n = 48) породы дюрок несет гомозиготный генотип АА - 64,0%, доля гетерозиготных АВ - 30,7%, а гомозиготных ВВ - 5,3%. По частоте встречаемости генотипов у свиней породы скороспелая мясная степного типа распределились следующим образом: АА генотип несли 45,3% (n = 34), АВ – 46,7% (n = 35), ВВ – 5,3% (n = 6) животных.

Наибольшая разница между числом фактического и теоретического распределения генотипов (больший недостаток гетерозигот) отмечена по гетерозиготному варианту АВ у породы дюрок - 23,0 против 24,8, в то время как в популяции свиней СМ-1 СТ этот показатель составил 35,0 против 32,6. Показатель вариабельности хи-квадрат у свиней породы дюрок составил - 0,315, у скороспелой мясной степного типа – 0,702 и не превышал его табличного значения. В результате полученных данных можно сделать вывод, что по гену эстрогенового рецептора генное равновесие не нарушено.

Степень гомозиготности (Са) в исследованной популяции свиней породы дюрок составила 66,8%, СМ-1СТ – 56,4%, что свидетельствует о более высокой степени консолидации в стаде породы дюрок (табл. 3). Число эффективно действующих аллелей в гене ESR свиней породы дюрок составило – 1,50, СМ-1 СТ – 1,77, при максимальном значении уровня полиморфности возможном при двухаллельном локусе.

Таблица 3 - Генетическая структура пород свиней по гену эстрогенного рецептора



Показатели

Порода

Дюрок,

n=75

Скороспелая мясная СТ, n=75

Фактически

Теоретически

Фактически

Теоретически

Гетерозиготы

23

24,88

35

32,64

Гомозиготы

52

50,1

40

42,3

Коэффициент гетеро/гомозиготы

0,442

0,496

0,875

0,772

Тест гетерозиготности, ТГ

-0,054

-

0,103

-

Степень гомозиготности, Са, %

66,82

-

56,4

-

Уровень полиморфности, Nа

1,50

-

1,77

-

Доля гомозигот, %

69,3

-

53,3

-


Тест гетерозиготности (ТГ), свидетельствующий об уровне генетического разнообразия популяции в исследованных стадах, был отрицательным в породе дюрок и составил – 0,054, но положительным у СМ-1 СТ - 0,103, что свидетельствует о недостаточной гетерозиготности в обеих популяциях.

Анализ воспроизводительных качеств свиноматок свидетельствует о том, что наибольшей плодовитостью характеризовались свиноматки с генотипом ВВ как в породе дюрок, так и СМ-1 СТ.

Разница по такому показателю, как многоплодие свиноматок, характеризующему общее количество поросят при рождении, между группами к ВВ генотипу, составила у дюрок – 5,9 и 2,4%, у СМ-1 СТ – 5,3 и 1,8%, по сравнению с АА и АВ генотипами, соответственно. При изучении крупноплодности не установлено достоверной разницы между генотипами в изучаемых группах.
Таблица 4 – Воспроизводительные качества свиней разных генотипов по локусу эстрогенового рецептора



Показатели

Генотипы

Дюрок

СМ-1СТ

АА

M±m

АВ

M±m

ВВ

M±m

АА

M±m

АВ

M±m

ВВ

M±m

Многоплодие поросят, гол.

7,9

±0,06

8,2

±0,06

8,4

±0,09***

10,9

±0,01

11,0

±0,06

11,1

±0,05*

Крупноплодность, кг.

1,45

±0,02

1,53

±0,02

1,50

±0,04*

1,2

±0,04

1,3

±0,02

1,4

±0,07***

Масса гнезда при рожд., кг.

11,4

±0,03

12,5

±0,04

12,6

±0,07***

13,8

±0,06

14,3

±0,05

15,5

±0,07***

Молочность в 21 день, кг.

55,2

±0,13

58,1

±0,17

63,0

±0,21***

65,7

±0,23

70,4

±0,22

76,1

±0,03***

Масса гнезда в 2 мес., кг.

157,6

±0,17

165,2

±0,21

175,2

±0,22***

180,8

±0,30

197,5

±0,28

206,3

±0,10***

Количество поросят в 2 мес., гол.

7,1

±0,05

7,4

±0,05

7,8

±0,04***

9,5

±0,03

10,1

±0,05

10,5

±0,05***

Сохранность, %

89,8

±0,14

90,2

±0,12

92,8

±0,24**

89,6

±0,23

91,8

±0,22

93,7

±0,46**

КПВК, балл.

103

108

115

126

135

142

* – Р <0,05; ** – Р <0,01; *** – Р <0,001;
Достоверной разницы по живой массе поросят при рождении полученных от свиноматок разных генотипов по ESR гену не установлено. Однако большее количество поросят в гнезде свиноматок с ВВ генотипом обеспечило достоверное превосходство по массе гнезда над генотипами АА и АВ в породе дюрок – 10,5 и 0,8% , СМ-1 СТ – 12,3 и 8,4% (Р <0,001, Р <0,05) соответственно.

Данная закономерность прослеживается в двух месячном возрасте. Так, свиноматки с ВВ генотипом достоверно превосходили свиноматок с генотипами АА и АВ по массе гнезда в 2-х месячном возрасте у дюрок – 11,2 и 6,05%, СМ-1 СТ – 14,1 и 4,4% (Р <0,001) соответственно.

Установлено влияние генотипов гена ESR на молочность свиноматок. У свиноматок с генотипом АА и АВ молочность была меньше, чем у свиноматок с генотипом ВВ. В породе эта разница составила у дюрок - 14,1 и 8,4%, у скороспелой мясной степного типа – 15,8 и 8,1% (Р <0,001), соответственно. Сохранность была выше в группе свиноматок с ВВ генотипом по сравнению АА и АВ генотипами у дюрок на – 3,3 и 2,9%, СМ-1 СТ – 4,6 и 2,1% (Р <0,01), соответственно. Наибольший КПВК отмечен у свиноматок ВВ - генотипа, превышающий этот показатель свиноматок с АА - генотипом на 11,6 - у дюрок; 12,7 - у скороспелой мясной степного типа, с АВ генотипом – на 6,4; 5,2% соответственно.

У хряков породы СМ-1 СТ не выявлено достоверных различий по таким показателям как оплодотворяемость свиноматок, рождение живых поросят, крупноплодность, сохранность. Однако присутствие аллеля В свидетельствует о превосходстве животных с гетерозиготным АВ генотипом.
  1   2   3

Добавить документ в свой блог или на сайт

Похожие:

Продуктивные и некоторые биологические особенности овец бурятского...

Мясная продуктивность наиболее распространенных генотипов табунных лошадей Казахстана
Работа выполнена в ргп «Научно-производственный центр животноводства и ветеринарии»

Племенные и продуктивные качества коров-первотелок разных линий голштинской породы
Работа выполнена на кафедре «Кормление и разведение сельскохозяйственных животных» фгоу впо «Волгоградская государственная сельскохозяйственная...

09. 02. 2012 г. Ветеринарные правила содержания свиней в организациях...
...

Эффективность хозяйственного использования животных разных генотипов в холмогорской породе
Работа выполнена в фгоу впо «Рязанский государственный агротехнологический университет имени П. А. Костычева»

И качества молока коров черно-пестрой и холмогорской пород Корчагина...
Родительский индекс быка в большей степени оказывает влияние на рост удоя коров-дочерей, а родительский индекс коровы – на выход...

Мясная продуктивность бройлеров кросса «Иза» в условиях разных технологий выращивания
Птицеводство — одна из важнейших отраслей животноводства. От сельскохозяйственной птицы получают высококачественные продукты питания...

План мероприятий по предупреждению распространения и ликвидации вируса...
Рос­сийской Федерации в режим закрытого типа, а личные подсобные хозяйства, крестьянские (фермерские) хо­зяйства населения и свиноводческие...

Селекционно-генетические методы создания линий цесарок с аутосексной...

Африканская чума свиней: памятка населению
Африканская чума свиней – особо опасная, острозаразная, вирусная болезнь, известная с 1903 года, в России регистрируется с 2008 года....



База данных защищена авторским правом © 2013-2019
обратиться к администрации
vcvetu.ru